Transfection:Article Title: Spastin locally amplifies microtubule dynamics to pattern the axon for presynaptic cargo delivery.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BDNF PeproTech Cat# 450-02 NT-3 PeproTech Cat# 450-03 GDNF PeproTech Cat# 450-10 Lipofectamine Stem Transfection Reagent Thermo Fisher Cat# STEM00003 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Cat# 78442 ViralBoost Alstem Cat# VB100 Lentivirus Precipitation Solution Alstem Cat# VC100 Puromycin Takara Cat# 631305 Hibernate A Medium Brain Bits Cat# HA100 SNAP-Cell 647-SiR New England BioLabs Cat# S9102S SynaptoRed C2 Biotium Cat# 70027 D-AP5 Thomas Scientific Cat# 14539–5 ADVASEP-7 Biotium Cat# 70029 CNQX Thomas Scientific Cat# 14618–5 EveryBlot Blocking Buffer BIO-RAD Cat# 12010020 LI-COR Revert 700 Total Protein Stain LI-COR Cat# 926–11021 Critical commercial assays BCA Protein Assay Kit Thermo Fisher Cat# 23225 Plasmid Maxi Kit QIAGEN Cat# 12163 Experimental models: Cell lines Human: NGN2 iPSCs M. Ward (National Institutes of Health)31 N/A Human: HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Experimental models: Organisms/strains Rat: primary rat astrocytes/glia isolated from postnatal day 1 rat brains (Sprague Dawley) Charles River Laboratories RRID: RGD_737891 Oligonucleotides Spastin-specific sgRNA guide: GACCGACGGGAACCAAGCGA Horlbeck et al.39 N/A Non-targeting sgRNA guide: GTGCCAGCTTGTGGTGTCGT Horlbeck et al.39 N/A pCRISPRia-vs2 sequencing forward oligo: ggcttggatttctataacttcg This paper N/A pCRISPRia-vs2 sequencing reverse oligo: ctactgcacttatatacggttc This paper N/A Recombinant DNA Plasmid: pCRISPRia-vs2 Addgene Cat# 84832 Plasmid: pCRISPRia-vs2-Spastin Modified from pCRISPRia-vs2 N/A Plasmid: pCRISPRia-vs2-NT Modified from pCRISPRia-vs2 N/A Plasmid: pCMV-Vsv-g Addgene Cat# #8454 Plasmid: psPAX2 (HIV pol+gag) Addgene Cat# 12260 Plasmid: pCI-mScarlet Addgene Cat# 85042 Plasmid: pC1-mScarlet-Syp Modified from pCI-mScarlet N/A Plasmid: pCIG2-GFP-MACF43 Aiken et al.51 N/A Plasmid: pEGFP-C3-Syb Addgene Cat# 42308 Plasmid: pmScarlet-Syb Modified from pEGFP-C3-Syb N/A Plasmid: pCIG2-mScarlet-SybIRES-GFP-MACF43 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pCIG2-SNAP-M87 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pSNAPf New England Biolabs Cat# N9183S Plasmid: pCMV-Tag/WT M87 Addgene Cat# 89322 (Continued on next page) e2 Current Biology 34, 1–18.e1–e8, April 22, 2024 Article
Blocking Assay:Article Title: Spastin locally amplifies microtubule dynamics to pattern the axon for presynaptic cargo delivery.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BDNF PeproTech Cat# 450-02 NT-3 PeproTech Cat# 450-03 GDNF PeproTech Cat# 450-10 Lipofectamine Stem Transfection Reagent Thermo Fisher Cat# STEM00003 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Cat# 78442 ViralBoost Alstem Cat# VB100 Lentivirus Precipitation Solution Alstem Cat# VC100 Puromycin Takara Cat# 631305 Hibernate A Medium Brain Bits Cat# HA100 SNAP-Cell 647-SiR New England BioLabs Cat# S9102S SynaptoRed C2 Biotium Cat# 70027 D-AP5 Thomas Scientific Cat# 14539–5 ADVASEP-7 Biotium Cat# 70029 CNQX Thomas Scientific Cat# 14618–5 EveryBlot Blocking Buffer BIO-RAD Cat# 12010020 LI-COR Revert 700 Total Protein Stain LI-COR Cat# 926–11021 Critical commercial assays BCA Protein Assay Kit Thermo Fisher Cat# 23225 Plasmid Maxi Kit QIAGEN Cat# 12163 Experimental models: Cell lines Human: NGN2 iPSCs M. Ward (National Institutes of Health)31 N/A Human: HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Experimental models: Organisms/strains Rat: primary rat astrocytes/glia isolated from postnatal day 1 rat brains (Sprague Dawley) Charles River Laboratories RRID: RGD_737891 Oligonucleotides Spastin-specific sgRNA guide: GACCGACGGGAACCAAGCGA Horlbeck et al.39 N/A Non-targeting sgRNA guide: GTGCCAGCTTGTGGTGTCGT Horlbeck et al.39 N/A pCRISPRia-vs2 sequencing forward oligo: ggcttggatttctataacttcg This paper N/A pCRISPRia-vs2 sequencing reverse oligo: ctactgcacttatatacggttc This paper N/A Recombinant DNA Plasmid: pCRISPRia-vs2 Addgene Cat# 84832 Plasmid: pCRISPRia-vs2-Spastin Modified from pCRISPRia-vs2 N/A Plasmid: pCRISPRia-vs2-NT Modified from pCRISPRia-vs2 N/A Plasmid: pCMV-Vsv-g Addgene Cat# #8454 Plasmid: psPAX2 (HIV pol+gag) Addgene Cat# 12260 Plasmid: pCI-mScarlet Addgene Cat# 85042 Plasmid: pC1-mScarlet-Syp Modified from pCI-mScarlet N/A Plasmid: pCIG2-GFP-MACF43 Aiken et al.51 N/A Plasmid: pEGFP-C3-Syb Addgene Cat# 42308 Plasmid: pmScarlet-Syb Modified from pEGFP-C3-Syb N/A Plasmid: pCIG2-mScarlet-SybIRES-GFP-MACF43 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pCIG2-SNAP-M87 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pSNAPf New England Biolabs Cat# N9183S Plasmid: pCMV-Tag/WT M87 Addgene Cat# 89322 (Continued on next page) e2 Current Biology 34, 1–18.e1–e8, April 22, 2024 Article
Staining:Article Title: Spastin locally amplifies microtubule dynamics to pattern the axon for presynaptic cargo delivery.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BDNF PeproTech Cat# 450-02 NT-3 PeproTech Cat# 450-03 GDNF PeproTech Cat# 450-10 Lipofectamine Stem Transfection Reagent Thermo Fisher Cat# STEM00003 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Cat# 78442 ViralBoost Alstem Cat# VB100 Lentivirus Precipitation Solution Alstem Cat# VC100 Puromycin Takara Cat# 631305 Hibernate A Medium Brain Bits Cat# HA100 SNAP-Cell 647-SiR New England BioLabs Cat# S9102S SynaptoRed C2 Biotium Cat# 70027 D-AP5 Thomas Scientific Cat# 14539–5 ADVASEP-7 Biotium Cat# 70029 CNQX Thomas Scientific Cat# 14618–5 EveryBlot Blocking Buffer BIO-RAD Cat# 12010020 LI-COR Revert 700 Total Protein Stain LI-COR Cat# 926–11021 Critical commercial assays BCA Protein Assay Kit Thermo Fisher Cat# 23225 Plasmid Maxi Kit QIAGEN Cat# 12163 Experimental models: Cell lines Human: NGN2 iPSCs M. Ward (National Institutes of Health)31 N/A Human: HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Experimental models: Organisms/strains Rat: primary rat astrocytes/glia isolated from postnatal day 1 rat brains (Sprague Dawley) Charles River Laboratories RRID: RGD_737891 Oligonucleotides Spastin-specific sgRNA guide: GACCGACGGGAACCAAGCGA Horlbeck et al.39 N/A Non-targeting sgRNA guide: GTGCCAGCTTGTGGTGTCGT Horlbeck et al.39 N/A pCRISPRia-vs2 sequencing forward oligo: ggcttggatttctataacttcg This paper N/A pCRISPRia-vs2 sequencing reverse oligo: ctactgcacttatatacggttc This paper N/A Recombinant DNA Plasmid: pCRISPRia-vs2 Addgene Cat# 84832 Plasmid: pCRISPRia-vs2-Spastin Modified from pCRISPRia-vs2 N/A Plasmid: pCRISPRia-vs2-NT Modified from pCRISPRia-vs2 N/A Plasmid: pCMV-Vsv-g Addgene Cat# #8454 Plasmid: psPAX2 (HIV pol+gag) Addgene Cat# 12260 Plasmid: pCI-mScarlet Addgene Cat# 85042 Plasmid: pC1-mScarlet-Syp Modified from pCI-mScarlet N/A Plasmid: pCIG2-GFP-MACF43 Aiken et al.51 N/A Plasmid: pEGFP-C3-Syb Addgene Cat# 42308 Plasmid: pmScarlet-Syb Modified from pEGFP-C3-Syb N/A Plasmid: pCIG2-mScarlet-SybIRES-GFP-MACF43 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pCIG2-SNAP-M87 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pSNAPf New England Biolabs Cat# N9183S Plasmid: pCMV-Tag/WT M87 Addgene Cat# 89322 (Continued on next page) e2 Current Biology 34, 1–18.e1–e8, April 22, 2024 Article
Bicinchoninic Acid Protein Assay:Article Title: Spastin locally amplifies microtubule dynamics to pattern the axon for presynaptic cargo delivery.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BDNF PeproTech Cat# 450-02 NT-3 PeproTech Cat# 450-03 GDNF PeproTech Cat# 450-10 Lipofectamine Stem Transfection Reagent Thermo Fisher Cat# STEM00003 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Cat# 78442 ViralBoost Alstem Cat# VB100 Lentivirus Precipitation Solution Alstem Cat# VC100 Puromycin Takara Cat# 631305 Hibernate A Medium Brain Bits Cat# HA100 SNAP-Cell 647-SiR New England BioLabs Cat# S9102S SynaptoRed C2 Biotium Cat# 70027 D-AP5 Thomas Scientific Cat# 14539–5 ADVASEP-7 Biotium Cat# 70029 CNQX Thomas Scientific Cat# 14618–5 EveryBlot Blocking Buffer BIO-RAD Cat# 12010020 LI-COR Revert 700 Total Protein Stain LI-COR Cat# 926–11021 Critical commercial assays BCA Protein Assay Kit Thermo Fisher Cat# 23225 Plasmid Maxi Kit QIAGEN Cat# 12163 Experimental models: Cell lines Human: NGN2 iPSCs M. Ward (National Institutes of Health)31 N/A Human: HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Experimental models: Organisms/strains Rat: primary rat astrocytes/glia isolated from postnatal day 1 rat brains (Sprague Dawley) Charles River Laboratories RRID: RGD_737891 Oligonucleotides Spastin-specific sgRNA guide: GACCGACGGGAACCAAGCGA Horlbeck et al.39 N/A Non-targeting sgRNA guide: GTGCCAGCTTGTGGTGTCGT Horlbeck et al.39 N/A pCRISPRia-vs2 sequencing forward oligo: ggcttggatttctataacttcg This paper N/A pCRISPRia-vs2 sequencing reverse oligo: ctactgcacttatatacggttc This paper N/A Recombinant DNA Plasmid: pCRISPRia-vs2 Addgene Cat# 84832 Plasmid: pCRISPRia-vs2-Spastin Modified from pCRISPRia-vs2 N/A Plasmid: pCRISPRia-vs2-NT Modified from pCRISPRia-vs2 N/A Plasmid: pCMV-Vsv-g Addgene Cat# #8454 Plasmid: psPAX2 (HIV pol+gag) Addgene Cat# 12260 Plasmid: pCI-mScarlet Addgene Cat# 85042 Plasmid: pC1-mScarlet-Syp Modified from pCI-mScarlet N/A Plasmid: pCIG2-GFP-MACF43 Aiken et al.51 N/A Plasmid: pEGFP-C3-Syb Addgene Cat# 42308 Plasmid: pmScarlet-Syb Modified from pEGFP-C3-Syb N/A Plasmid: pCIG2-mScarlet-SybIRES-GFP-MACF43 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pCIG2-SNAP-M87 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pSNAPf New England Biolabs Cat# N9183S Plasmid: pCMV-Tag/WT M87 Addgene Cat# 89322 (Continued on next page) e2 Current Biology 34, 1–18.e1–e8, April 22, 2024 Article
Plasmid Preparation:Article Title: Spastin locally amplifies microtubule dynamics to pattern the axon for presynaptic cargo delivery.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BDNF PeproTech Cat# 450-02 NT-3 PeproTech Cat# 450-03 GDNF PeproTech Cat# 450-10 Lipofectamine Stem Transfection Reagent Thermo Fisher Cat# STEM00003 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Cat# 78442 ViralBoost Alstem Cat# VB100 Lentivirus Precipitation Solution Alstem Cat# VC100 Puromycin Takara Cat# 631305 Hibernate A Medium Brain Bits Cat# HA100 SNAP-Cell 647-SiR New England BioLabs Cat# S9102S SynaptoRed C2 Biotium Cat# 70027 D-AP5 Thomas Scientific Cat# 14539–5 ADVASEP-7 Biotium Cat# 70029 CNQX Thomas Scientific Cat# 14618–5 EveryBlot Blocking Buffer BIO-RAD Cat# 12010020 LI-COR Revert 700 Total Protein Stain LI-COR Cat# 926–11021 Critical commercial assays BCA Protein Assay Kit Thermo Fisher Cat# 23225 Plasmid Maxi Kit QIAGEN Cat# 12163 Experimental models: Cell lines Human: NGN2 iPSCs M. Ward (National Institutes of Health)31 N/A Human: HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Experimental models: Organisms/strains Rat: primary rat astrocytes/glia isolated from postnatal day 1 rat brains (Sprague Dawley) Charles River Laboratories RRID: RGD_737891 Oligonucleotides Spastin-specific sgRNA guide: GACCGACGGGAACCAAGCGA Horlbeck et al.39 N/A Non-targeting sgRNA guide: GTGCCAGCTTGTGGTGTCGT Horlbeck et al.39 N/A pCRISPRia-vs2 sequencing forward oligo: ggcttggatttctataacttcg This paper N/A pCRISPRia-vs2 sequencing reverse oligo: ctactgcacttatatacggttc This paper N/A Recombinant DNA Plasmid: pCRISPRia-vs2 Addgene Cat# 84832 Plasmid: pCRISPRia-vs2-Spastin Modified from pCRISPRia-vs2 N/A Plasmid: pCRISPRia-vs2-NT Modified from pCRISPRia-vs2 N/A Plasmid: pCMV-Vsv-g Addgene Cat# #8454 Plasmid: psPAX2 (HIV pol+gag) Addgene Cat# 12260 Plasmid: pCI-mScarlet Addgene Cat# 85042 Plasmid: pC1-mScarlet-Syp Modified from pCI-mScarlet N/A Plasmid: pCIG2-GFP-MACF43 Aiken et al.51 N/A Plasmid: pEGFP-C3-Syb Addgene Cat# 42308 Plasmid: pmScarlet-Syb Modified from pEGFP-C3-Syb N/A Plasmid: pCIG2-mScarlet-SybIRES-GFP-MACF43 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pCIG2-SNAP-M87 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pSNAPf New England Biolabs Cat# N9183S Plasmid: pCMV-Tag/WT M87 Addgene Cat# 89322 (Continued on next page) e2 Current Biology 34, 1–18.e1–e8, April 22, 2024 Article
Isolation:Article Title: Spastin locally amplifies microtubule dynamics to pattern the axon for presynaptic cargo delivery.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BDNF PeproTech Cat# 450-02 NT-3 PeproTech Cat# 450-03 GDNF PeproTech Cat# 450-10 Lipofectamine Stem Transfection Reagent Thermo Fisher Cat# STEM00003 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Cat# 78442 ViralBoost Alstem Cat# VB100 Lentivirus Precipitation Solution Alstem Cat# VC100 Puromycin Takara Cat# 631305 Hibernate A Medium Brain Bits Cat# HA100 SNAP-Cell 647-SiR New England BioLabs Cat# S9102S SynaptoRed C2 Biotium Cat# 70027 D-AP5 Thomas Scientific Cat# 14539–5 ADVASEP-7 Biotium Cat# 70029 CNQX Thomas Scientific Cat# 14618–5 EveryBlot Blocking Buffer BIO-RAD Cat# 12010020 LI-COR Revert 700 Total Protein Stain LI-COR Cat# 926–11021 Critical commercial assays BCA Protein Assay Kit Thermo Fisher Cat# 23225 Plasmid Maxi Kit QIAGEN Cat# 12163 Experimental models: Cell lines Human: NGN2 iPSCs M. Ward (National Institutes of Health)31 N/A Human: HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Experimental models: Organisms/strains Rat: primary rat astrocytes/glia isolated from postnatal day 1 rat brains (Sprague Dawley) Charles River Laboratories RRID: RGD_737891 Oligonucleotides Spastin-specific sgRNA guide: GACCGACGGGAACCAAGCGA Horlbeck et al.39 N/A Non-targeting sgRNA guide: GTGCCAGCTTGTGGTGTCGT Horlbeck et al.39 N/A pCRISPRia-vs2 sequencing forward oligo: ggcttggatttctataacttcg This paper N/A pCRISPRia-vs2 sequencing reverse oligo: ctactgcacttatatacggttc This paper N/A Recombinant DNA Plasmid: pCRISPRia-vs2 Addgene Cat# 84832 Plasmid: pCRISPRia-vs2-Spastin Modified from pCRISPRia-vs2 N/A Plasmid: pCRISPRia-vs2-NT Modified from pCRISPRia-vs2 N/A Plasmid: pCMV-Vsv-g Addgene Cat# #8454 Plasmid: psPAX2 (HIV pol+gag) Addgene Cat# 12260 Plasmid: pCI-mScarlet Addgene Cat# 85042 Plasmid: pC1-mScarlet-Syp Modified from pCI-mScarlet N/A Plasmid: pCIG2-GFP-MACF43 Aiken et al.51 N/A Plasmid: pEGFP-C3-Syb Addgene Cat# 42308 Plasmid: pmScarlet-Syb Modified from pEGFP-C3-Syb N/A Plasmid: pCIG2-mScarlet-SybIRES-GFP-MACF43 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pCIG2-SNAP-M87 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pSNAPf New England Biolabs Cat# N9183S Plasmid: pCMV-Tag/WT M87 Addgene Cat# 89322 (Continued on next page) e2 Current Biology 34, 1–18.e1–e8, April 22, 2024 Article
Sequencing:Article Title: Spastin locally amplifies microtubule dynamics to pattern the axon for presynaptic cargo delivery.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BDNF PeproTech Cat# 450-02 NT-3 PeproTech Cat# 450-03 GDNF PeproTech Cat# 450-10 Lipofectamine Stem Transfection Reagent Thermo Fisher Cat# STEM00003 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Cat# 78442 ViralBoost Alstem Cat# VB100 Lentivirus Precipitation Solution Alstem Cat# VC100 Puromycin Takara Cat# 631305 Hibernate A Medium Brain Bits Cat# HA100 SNAP-Cell 647-SiR New England BioLabs Cat# S9102S SynaptoRed C2 Biotium Cat# 70027 D-AP5 Thomas Scientific Cat# 14539–5 ADVASEP-7 Biotium Cat# 70029 CNQX Thomas Scientific Cat# 14618–5 EveryBlot Blocking Buffer BIO-RAD Cat# 12010020 LI-COR Revert 700 Total Protein Stain LI-COR Cat# 926–11021 Critical commercial assays BCA Protein Assay Kit Thermo Fisher Cat# 23225 Plasmid Maxi Kit QIAGEN Cat# 12163 Experimental models: Cell lines Human: NGN2 iPSCs M. Ward (National Institutes of Health)31 N/A Human: HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Experimental models: Organisms/strains Rat: primary rat astrocytes/glia isolated from postnatal day 1 rat brains (Sprague Dawley) Charles River Laboratories RRID: RGD_737891 Oligonucleotides Spastin-specific sgRNA guide: GACCGACGGGAACCAAGCGA Horlbeck et al.39 N/A Non-targeting sgRNA guide: GTGCCAGCTTGTGGTGTCGT Horlbeck et al.39 N/A pCRISPRia-vs2 sequencing forward oligo: ggcttggatttctataacttcg This paper N/A pCRISPRia-vs2 sequencing reverse oligo: ctactgcacttatatacggttc This paper N/A Recombinant DNA Plasmid: pCRISPRia-vs2 Addgene Cat# 84832 Plasmid: pCRISPRia-vs2-Spastin Modified from pCRISPRia-vs2 N/A Plasmid: pCRISPRia-vs2-NT Modified from pCRISPRia-vs2 N/A Plasmid: pCMV-Vsv-g Addgene Cat# #8454 Plasmid: psPAX2 (HIV pol+gag) Addgene Cat# 12260 Plasmid: pCI-mScarlet Addgene Cat# 85042 Plasmid: pC1-mScarlet-Syp Modified from pCI-mScarlet N/A Plasmid: pCIG2-GFP-MACF43 Aiken et al.51 N/A Plasmid: pEGFP-C3-Syb Addgene Cat# 42308 Plasmid: pmScarlet-Syb Modified from pEGFP-C3-Syb N/A Plasmid: pCIG2-mScarlet-SybIRES-GFP-MACF43 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pCIG2-SNAP-M87 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pSNAPf New England Biolabs Cat# N9183S Plasmid: pCMV-Tag/WT M87 Addgene Cat# 89322 (Continued on next page) e2 Current Biology 34, 1–18.e1–e8, April 22, 2024 Article
Recombinant:Article Title: Spastin locally amplifies microtubule dynamics to pattern the axon for presynaptic cargo delivery.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BDNF PeproTech Cat# 450-02 NT-3 PeproTech Cat# 450-03 GDNF PeproTech Cat# 450-10 Lipofectamine Stem Transfection Reagent Thermo Fisher Cat# STEM00003 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Cat# 78442 ViralBoost Alstem Cat# VB100 Lentivirus Precipitation Solution Alstem Cat# VC100 Puromycin Takara Cat# 631305 Hibernate A Medium Brain Bits Cat# HA100 SNAP-Cell 647-SiR New England BioLabs Cat# S9102S SynaptoRed C2 Biotium Cat# 70027 D-AP5 Thomas Scientific Cat# 14539–5 ADVASEP-7 Biotium Cat# 70029 CNQX Thomas Scientific Cat# 14618–5 EveryBlot Blocking Buffer BIO-RAD Cat# 12010020 LI-COR Revert 700 Total Protein Stain LI-COR Cat# 926–11021 Critical commercial assays BCA Protein Assay Kit Thermo Fisher Cat# 23225 Plasmid Maxi Kit QIAGEN Cat# 12163 Experimental models: Cell lines Human: NGN2 iPSCs M. Ward (National Institutes of Health)31 N/A Human: HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Experimental models: Organisms/strains Rat: primary rat astrocytes/glia isolated from postnatal day 1 rat brains (Sprague Dawley) Charles River Laboratories RRID: RGD_737891 Oligonucleotides Spastin-specific sgRNA guide: GACCGACGGGAACCAAGCGA Horlbeck et al.39 N/A Non-targeting sgRNA guide: GTGCCAGCTTGTGGTGTCGT Horlbeck et al.39 N/A pCRISPRia-vs2 sequencing forward oligo: ggcttggatttctataacttcg This paper N/A pCRISPRia-vs2 sequencing reverse oligo: ctactgcacttatatacggttc This paper N/A Recombinant DNA Plasmid: pCRISPRia-vs2 Addgene Cat# 84832 Plasmid: pCRISPRia-vs2-Spastin Modified from pCRISPRia-vs2 N/A Plasmid: pCRISPRia-vs2-NT Modified from pCRISPRia-vs2 N/A Plasmid: pCMV-Vsv-g Addgene Cat# #8454 Plasmid: psPAX2 (HIV pol+gag) Addgene Cat# 12260 Plasmid: pCI-mScarlet Addgene Cat# 85042 Plasmid: pC1-mScarlet-Syp Modified from pCI-mScarlet N/A Plasmid: pCIG2-GFP-MACF43 Aiken et al.51 N/A Plasmid: pEGFP-C3-Syb Addgene Cat# 42308 Plasmid: pmScarlet-Syb Modified from pEGFP-C3-Syb N/A Plasmid: pCIG2-mScarlet-SybIRES-GFP-MACF43 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pCIG2-SNAP-M87 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pSNAPf New England Biolabs Cat# N9183S Plasmid: pCMV-Tag/WT M87 Addgene Cat# 89322 (Continued on next page) e2 Current Biology 34, 1–18.e1–e8, April 22, 2024 Article
Modification:Article Title: Spastin locally amplifies microtubule dynamics to pattern the axon for presynaptic cargo delivery.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BDNF PeproTech Cat# 450-02 NT-3 PeproTech Cat# 450-03 GDNF PeproTech Cat# 450-10 Lipofectamine Stem Transfection Reagent Thermo Fisher Cat# STEM00003 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Cat# 78442 ViralBoost Alstem Cat# VB100 Lentivirus Precipitation Solution Alstem Cat# VC100 Puromycin Takara Cat# 631305 Hibernate A Medium Brain Bits Cat# HA100 SNAP-Cell 647-SiR New England BioLabs Cat# S9102S SynaptoRed C2 Biotium Cat# 70027 D-AP5 Thomas Scientific Cat# 14539–5 ADVASEP-7 Biotium Cat# 70029 CNQX Thomas Scientific Cat# 14618–5 EveryBlot Blocking Buffer BIO-RAD Cat# 12010020 LI-COR Revert 700 Total Protein Stain LI-COR Cat# 926–11021 Critical commercial assays BCA Protein Assay Kit Thermo Fisher Cat# 23225 Plasmid Maxi Kit QIAGEN Cat# 12163 Experimental models: Cell lines Human: NGN2 iPSCs M. Ward (National Institutes of Health)31 N/A Human: HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Experimental models: Organisms/strains Rat: primary rat astrocytes/glia isolated from postnatal day 1 rat brains (Sprague Dawley) Charles River Laboratories RRID: RGD_737891 Oligonucleotides Spastin-specific sgRNA guide: GACCGACGGGAACCAAGCGA Horlbeck et al.39 N/A Non-targeting sgRNA guide: GTGCCAGCTTGTGGTGTCGT Horlbeck et al.39 N/A pCRISPRia-vs2 sequencing forward oligo: ggcttggatttctataacttcg This paper N/A pCRISPRia-vs2 sequencing reverse oligo: ctactgcacttatatacggttc This paper N/A Recombinant DNA Plasmid: pCRISPRia-vs2 Addgene Cat# 84832 Plasmid: pCRISPRia-vs2-Spastin Modified from pCRISPRia-vs2 N/A Plasmid: pCRISPRia-vs2-NT Modified from pCRISPRia-vs2 N/A Plasmid: pCMV-Vsv-g Addgene Cat# #8454 Plasmid: psPAX2 (HIV pol+gag) Addgene Cat# 12260 Plasmid: pCI-mScarlet Addgene Cat# 85042 Plasmid: pC1-mScarlet-Syp Modified from pCI-mScarlet N/A Plasmid: pCIG2-GFP-MACF43 Aiken et al.51 N/A Plasmid: pEGFP-C3-Syb Addgene Cat# 42308 Plasmid: pmScarlet-Syb Modified from pEGFP-C3-Syb N/A Plasmid: pCIG2-mScarlet-SybIRES-GFP-MACF43 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pCIG2-SNAP-M87 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pSNAPf New England Biolabs Cat# N9183S Plasmid: pCMV-Tag/WT M87 Addgene Cat# 89322 (Continued on next page) e2 Current Biology 34, 1–18.e1–e8, April 22, 2024 Article
|
LI-COR is a verified supplier 
LI-COR manufactures this product 